XX. celostátní konference DNA diagnostiky

3. – 4. 11. 2016 / Dolní Morava

Drahé kolegyně, drazí kolegové, milovnice a milovníci a obdivovatelky a obdivovatelé deoxyribonukleových kyselin,

je nám velkou ctí zhostit se organizace již tradičního tentokráte jubilejního 20. setkání v rámci prestižní konference DNA diagnostiky. Dovolte nám pozvat vás všechny pro změnu opět do velmi malebného prostředí Králického Sněžníku do areálu hotelu Vista. Věříme, že odborné prezentace vašich bádání, se kterými do hor přijedete, napomohou rozluštit alespoň některou z mnoha hádanek, které nám lidský genom neustále vytváří.

Jistě se již neobejdeme bez nových děsivě velkokapacitních technologií. Většina z nás již plynule ovládá velmi čtivý FASTQ jazyk a v textu

@RGXMP:00004:00014ATTTTCTTCATTCCTGGGGAGTACTAACCCAAAAGCGTCTGTCTCTTGTTTTCTAGTCCAGTTTGAGATTAATTTAGAAGAAAGGAATACTGTATGTGAAATTCATCTTGGGCTTTCCCCT+;BBB7CC?BCB?B@BCCC:BECCBBB@BB>ABB:BBA@ACC@B>>=<@<5?>?A@@>@@AA<A@@@@?A>AA<@@@>@@B7<9==?>?@@<??:;9=7///4660>>>0888.8 @RGXMP:00004:00020TTCAGGGCCCAACTTCTCTGTGGCCTATGCCAACATGTGCCGCTGCCTCATGGCGGTTAGTTTCCAGTGGGTTCTAAATCTAATGGTCTGGTTGCCCATTCCTATTCCAAGACTCCTTG+@@CBBB@BC<B?A?=ACDCBA?@B@??AA@>?>?@@@@?<;;;;==;<;;;;<=;=;:;<=<A>?@@B=:?<?ABC;@>>>>AA>????<:;884997979;;7;8<9<AAA@<@?A @RGXMP:00004:00025GTAAACAGGTCTC+68//+///,//,, @RGXMP:00004:00027ACAGAGCATGGCCTTTAAATAACTCTAGAGATTTTTGTGCTAATTATTTTCTTTTTTCCGCAGGCCATACAGGCAGCCCATGATGCCGTGGCACAGGAAGGCCAATGTCGGGTAAATGCAAATACAAATCGGAGCCAGGCTGCCTGGGTGCCATCTGTGTTTCTACTG+AABBBCBBBB>B@BD>AA?BB@FFCCCB;;99444!9ACBBC@B?@>>>4999888*8=>A@?=@@AAAC??>?BCEC?ACCC;;;?BAA>ACCB@>B5:5<?A<AA@ACC@CCDACBBAA>ACCDCC;:::==927747=>A=@@A:<=<C@@?>>888?:=?A~==

lehce odhalí, že například v  posledním rídu nelze příliš věřit třicátému šestému téčku, zato stošedesáté šesté céčko nemá chybu.

Po kontrole a všelikém čištění rídů se pomocí různých algoritmů a prográmků střemhlav vrháme do jejich přiřazování k referenčním sekvencím a anotujeme tak dlouho, dokud není i ta poslední nalezená varianta v genu prohlášena za benigní.


Vlastnímu programu předchází bioinformatický workshop zaměřený na třídění a vyhodnocování MPS dat.

Pevně věříme, že bude naše setkání opětovně naladěné na pozitivní, inspirativní a přátelskou atmosféru.


Těší se na vás na všechny za organizátory

Radek Vodička, Radek Vrtěl a Martin Procházka

Předběžný program konference

  • Témata vašich prezentací by měla obsahově zapadnout do širokého spektra molekulárně – genetických analýz. Měla by se týkat např. mutačních, genotypizačních, genomových diagnostických postupů v oblastech mendelovské/nemendelovské genetiky, v onkogenetice, prenatální a preimplantační diagnostice.
  • Součástí konference bude i bioinformatická sekce, ve které by měly zaznít zkušenosti se zpracováním NGS (MPS) dat a s hodnocením potenciálního klinického dopadu genetických variant.
  • V rámci konference bude rovněž věnován prostor mezilaboratorní kontrole kvality, její organizaci a hodnocení výsledků.
  • Konferenci předchází pracovní setkání pořádané společností SEQme (2. 11. 2016), které bude tematicky zaměřené na zpracování a vyhodnocování NGS dat. Více informací